produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Produce a simulate-able SDF of an arbitrary mesh with convex decomposition.

Mesh-to-SDF converter Given a (potentially nasty, nonconvex) mesh, automatically creates an SDF file that describes that object. The visual geometry i

Greg Izatt 22 Nov 23, 2022
This python program will display all SSID usernames and SSID passwords you once connected to your laptop

Windows-Wifi-password-extractor This python program will display all SSID usernames and SSID passwords you once connected to your laptop How to run th

Bhaskar Pal 3 Apr 26, 2022
Adding two matrix from scratch using python.

Adding-two-matrix-from-scratch-using-python. Here, I have take two matrix from user and add it without using any library. I made this program from scr

Sachin Vinayak Dabhade 4 Sep 24, 2021
Fraud Multiplication Table Detection in python

Fraud-Multiplication-Table-Detection-in-python In this program, I have detected fraud multiplication table using python without class. Here, I have co

Sachin Vinayak Dabhade 4 Sep 24, 2021
NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

Aero 1 Mar 31, 2022
A utility that makes it easy to work with Python projects containing lots of packages, of which you only want to develop some.

Mixed development source packages on top of stable constraints using pip mxdev [mɪks dɛv] is a utility that makes it easy to work with Python projects

BlueDynamics Alliance 6 Jun 08, 2022
Python module and its web equivalent, to hide text within text by manipulating bits

cacherdutexte.github.io This project contains : Python modules (binary and decimal system 6) with a dedicated tkinter program to use it. A web version

2 Sep 04, 2022
A python module to manipulate XCode projects

This module can read, modify, and write a .pbxproj file from an Xcode 4+ projects. The file is usually called project.pbxproj and can be found inside the .xcodeproj bundle. Because some task cannot b

Ignacio Calderon 1.1k Jan 02, 2023
Functional UUIDs for Python.

🏷️FUUID stands for Functional Universally Unique IDentifier. FUUIDs are compatible with regular UUIDs but are naturally ordered by generation time, collision-free and support succinct representations

Phil Demetriou 147 Oct 27, 2022
A python mathematics module

A python mathematics module

Fayas Noushad 4 Nov 28, 2021
Modeling Category-Selective Cortical Regions with Topographic Variational Autoencoders

Modeling Category-Selective Cortical Regions with Topographic Variational Autoencoders Getting Started Install requirements with Anaconda: conda env c

T. Andy Keller 4 Aug 22, 2022
Script to rename and resize folders of images

script to rename and resize folders of images

Tega Brain 2 Oct 29, 2021
A simple package for handling variables in string.

A simple package for handling string variables. Welcome! This is a simple package for handling variables in string, You can add or remove variables wi

1 Dec 31, 2021
JeNot - A tool to notify you when Jenkins builds are done.

JeNot - Jenkins Notifications NOTE: under construction, buggy, and not production-ready What A tool to notify you when Jenkins builds are done. Why Je

1 Jun 24, 2022
This is Cool Utility tools that you can use in python.

This is Cool Utility tools that you can use in python. There are a few tools that you might find very useful, you can use this on pretty much any project and some utils might help you a lot and save

Senarc Studios 6 Apr 18, 2022
Michael Vinyard's utilities

Install vintools To download this package from pypi: pip install vintools Install the development package To download and install the developmen

Michael Vinyard 2 May 22, 2022
Dill_tils is a package that has my commonly used functions inside it for ease of use.

DilllonB07 Utilities Dill_tils is a package that has my commonly used functions inside it for ease of use. Installation Anyone can use this package by

Dillon Barnes 2 Dec 05, 2021
Aggregating gridded data (xarray) to polygons

A package to aggregate gridded data in xarray to polygons in geopandas using area-weighting from the relative area overlaps between pixels and polygons.

Kevin Schwarzwald 42 Nov 09, 2022
Numbers-parser - Python module for parsing Apple Numbers .numbers files

numbers-parser numbers-parser is a Python module for parsing Apple Numbers .numbers files. It supports Numbers files generated by Numbers version 10.3

Jon Connell 154 Jan 05, 2023
A simple example for calling C++ functions in Python by `ctypes`.

ctypes-example A simple example for calling C++ functions in Python by ctypes. Features call C++ function int bar(int* value, char* msg) with argumene

Yusu Pan 3 Nov 23, 2022