produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Simple RGB to HEX game made in python

Simple RGB to HEX game made in python

5 Aug 26, 2022
Gradually automate your procedures, one step at a time

Gradualist Gradually automate your procedures, one step at a time Inspired by https://blog.danslimmon.com/2019/07/15/ Features Main Features Converts

Ross Jacobs 8 Jul 24, 2022
Audio Steganography is a technique used to transmit hidden information by modifying an audio signal in an imperceptible manner.

Audio Steganography Audio Steganography is a technique used to transmit hidden information by modifying an audio signal in an imperceptible manner. Ab

Karan Yuvraj Singh 1 Oct 17, 2021
New time-based UUID formats which are suited for use as a database key

uuid6 New time-based UUID formats which are suited for use as a database key. This module extends immutable UUID objects (the UUID class) with the fun

26 Dec 30, 2022
NFT-Generator is the best way to generate thousands of NFTs quick and easily with Python.

NFT-Generator is the best way to generate thousands of NFTs quick and easily with Python. Just add your files, set your configuration and run the scri

78 Dec 27, 2022
glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

gle_ip_info glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

Fatin Shadab 3 Nov 21, 2021
This two python programs can convert km to miles and miles to km

km-to-miles These two little python programs can convert kilometers to miles and miles to kilometers Needed Python3 or a online python compiler with t

Chandula Janith 3 Jan 30, 2022
jsoooooooon derulo - Make sure your 'jason derulo' is featured as the first part of your json data

jsonderulo Make sure your 'jason derulo' is featured as the first part of your json data Install: # python pip install jsonderulo poetry add jsonderul

jesse 3 Sep 13, 2021
An OData v4 query parser and transpiler for Python

odata-query is a library that parses OData v4 filter strings, and can convert them to other forms such as Django Queries, SQLAlchemy Queries, or just plain SQL.

Gorilla 39 Jan 05, 2023
Tools for binary data on cassette

Micro Manchester Tape Storage Tools for storing binary data on cassette Includes: Python script for encoding Arduino sketch for decoding Eagle CAD fil

Zack Nelson 28 Dec 25, 2022
A python lib for generate random string and digits and special characters or A combination of them

A python lib for generate random string and digits and special characters or A combination of them

Torham 4 Nov 15, 2022
API for obtaining results from the Beery-Bukenica test of the visomotor integration development (VMI) 4th edition.

VMI API API for obtaining results from the Beery-Bukenica test of the visomotor integration development (VMI) 4th edition. Install docker-compose up -

Victor Vargas Sandoval 1 Oct 26, 2021
Color getter (including method to get random color or complementary color) made out of Python

python-color-getter Color getter (including method to get random color or complementary color) made out of Python Setup pip3 install git+https://githu

Jung Gyu Yoon 2 Sep 17, 2022
A thing to simplify listening for PG notifications with asyncpg

asyncpg-listen This library simplifies usage of listen/notify with asyncpg: Handles loss of a connection Simplifies notifications processing from mult

ANNA 18 Dec 23, 2022
Daiho Tool is a Script Gathering for Windows/Linux systems written in Python.

Daiho is a Script Developed with Python3. It gathers a total of 22 Discord tools (including a RAT, a Raid Tool, a Nuker Tool, a Token Grabberr, etc). It has a pleasant and intuitive interface to faci

AstraaDev 32 Jan 05, 2023
This tool analyzes the json files generated by stream-lnd-htlcs to find hidden channel demand.

analyze_lnd_htlc Introduction Rebalancing channels is an important part of running a Lightning Network node. While it would be great if all channels c

Marimox 4 Dec 08, 2022
✨ Un générateur de lien raccourcis en fonction d'un lien totalement fait en Python par moi, et en français.

Shorter Link ❗ Un générateur de lien raccourcis en fonction d'un lien totalement fait en Python par moi, et en français. Dépendences : pip install pys

MrGabin 3 Jun 06, 2021
A string extractor module for python

A string extractor module for python

Fayas Noushad 4 Jul 19, 2022
Install, run, and update apps without root and only in your home directory

Qube Apps Install, run, and update apps in the private storage of a Qube. Build and install in Qubes Get the code: git clone https://github.com/micahf

Micah Lee 26 Dec 27, 2022
Small project to interact with python, C, HTML, JavaScript, PHP.

Micro Hidroponic Small project to interact with python, C, HTML, JavaScript, PHP. Table of Contents General Info Technologies Used Screenshots Usage P

Filipe Martins 1 Nov 10, 2021