produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Tools for binary data on cassette

Micro Manchester Tape Storage Tools for storing binary data on cassette Includes: Python script for encoding Arduino sketch for decoding Eagle CAD fil

Zack Nelson 28 Dec 25, 2022
Utility to extract Fantasy Grounds Unity Line-of-sight and lighting files from a Univeral VTT file exported from Dungeondraft

uvtt2fgu Utility to extract Fantasy Grounds Unity Line-of-sight and lighting files from a Univeral VTT file exported from Dungeondraft This program wo

Andre Kostur 29 Dec 05, 2022
A primitive Python wrapper around the Gromacs tools.

README: GromacsWrapper A primitive Python wrapper around the Gromacs tools. The library is tested with GROMACS 4.6.5, 2018.x, 2019.x, 2020.x, and 2021

Becksteinlab 140 Dec 28, 2022
Monte Carlo simulation of 3G rules

mc3g Monte Carlo simulation of 3G rules This project contains the Python code to do simulations of events according to the 3G rule (in German: "Geimpf

Jan Christoph Terasa 4 Nov 01, 2021
A python module to validate input.

A python module to validate input.

Matthias 6 Sep 13, 2022
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

Aero 1 Mar 31, 2022
Find version automatically based on git tags and commit messages.

GIT-CONVENTIONAL-VERSION Find version automatically based on git tags and commit messages. The tool is very specific in its function, so it is very fl

0 Nov 07, 2021
Lark is a parsing toolkit for Python, built with a focus on ergonomics, performance and modularity.

Lark is a parsing toolkit for Python, built with a focus on ergonomics, performance and modularity.

Lark - Parsing Library & Toolkit 3.5k Jan 05, 2023
A Randomizer Oracle

Tezos Randomizer Tezod Randomizer "Oracle". It's a smart contract that you can call to get a random number between X and Y (for now). It uses entropy

Asbjorn Enge 19 Sep 13, 2022
Create powerful passwords easily and with many options with this program

Password_Generator About the Program: You can create powerful passwords with this program with many options easily! Features: You can copy the generat

Sina.f 0 Jul 14, 2022
This utility synchronises spelling dictionaries from various tools with each other.

This utility synchronises spelling dictionaries from various tools with each other. This way the words that have been trained on MS Office are also correctly checked in vim or Firefox. And vice versa

Patrice Neff 2 Feb 11, 2022
Produce a simulate-able SDF of an arbitrary mesh with convex decomposition.

Mesh-to-SDF converter Given a (potentially nasty, nonconvex) mesh, automatically creates an SDF file that describes that object. The visual geometry i

Greg Izatt 22 Nov 23, 2022
Python tool to check a web applications compliance with OWASP HTTP response headers best practices

Check Your Head A quick and easy way to check a web applications response headers!

Zak 6 Nov 09, 2021
python script to generate color coded resistor images

Resistor image generator I got nerdsniped into making this. It's not finished at all, and the code is messy. The end goal it generate a whole E-series

MichD 1 Nov 12, 2021
A work in progress box containing various Python utilities

python-wipbox A set of modern Python libraries under development to simplify the execution of reusable routines by different projects. Table of Conten

Deepnox 2 Jan 20, 2022
Simple profile athena generator for Fortnite Private Servers.

Profile-Athena-Generator A simple profile athena generator for Fortnite Private Servers. This profile athena generrator features: Item variants Get al

Fevers 10 Aug 27, 2022
Backup a folder to an another folder by using mirror update method.

Mirror Update Backup Backup a folder to an another folder by using mirror update method. How to use Install requirement pip install -r requirements.tx

1 Nov 21, 2022
Cleaning-utils - a collection of small Python functions and classes which make cleaning pipelines shorter and easier

cleaning-utils [] [] [] cleaning-utils is a collection of small Python functions

4 Aug 31, 2022
ecowater-softner is a Python library for collecting information from Ecowater water softeners.

Ecowater Softner ecowater-softner is a Python library for collecting information from Ecowater water softeners. Installation Use the package manager p

6 Dec 08, 2022