produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Simple code to generate a password for your account!

Password-Generator Simple code to generate a password for your account! Password Generator for passwords for your accounts or anything else! This code

DEEM 1 Jun 05, 2022
Python Libraries with functions and constants related to electrical engineering.

ElectricPy Electrical-Engineering-for-Python Python Libraries with functions and constants related to electrical engineering. The functions and consta

Joe Stanley 39 Dec 23, 2022
Creating low-level foundations and abstractions for asynchronous programming in Python.

DIY Async I/O Creating low-level foundations and abstractions for asynchronous programming in Python (i.e., implementing concurrency without using thr

Doc Jones 4 Dec 11, 2021
Raganarok X: Next Generation Data Dump

Raganarok X Data Dump Raganarok X: Next Generation Data Dump More interesting Files File Name Contains en_langs All the variables you need in English

14 Jul 15, 2022
Simple profile athena generator for Fortnite Private Servers.

Profile-Athena-Generator A simple profile athena generator for Fortnite Private Servers. This profile athena generrator features: Item variants Get al

Fevers 10 Aug 27, 2022
Tools to connect to and interact with the Mila cluster

milatools The milatools package provides the mila command, which is meant to help with connecting to and interacting with the Mila cluster. Install Re

Mila 32 Dec 01, 2022
Edit SRT files to delay subtitle time-stamps.

subtitle-delay A program written in Python that directly edits SRT file to delay the subtitles. Features: Will throw an error if delaying with negativ

8 Jul 17, 2022
Auto-generate /etc/hosts for HackTheBox machines

Auto-generate /etc/hosts for HackTheBox machines Save yourself some tedium on getting started on a new machine by having your /etc/hosts ready to go.

3 Feb 16, 2022
✨ Une calculatrice totalement faite en Python par moi, et en français.

Calculatrice ❗ Une calculatrice totalement faite en Python par moi, et en français. 🔮 Voici une calculatrice qui vous permet de faire vos additions,

MrGabin 3 Jun 06, 2021
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
Create powerful passwords easily and with many options with this program

Password_Generator About the Program: You can create powerful passwords with this program with many options easily! Features: You can copy the generat

Sina.f 0 Jul 14, 2022
Install, run, and update apps without root and only in your home directory

Qube Apps Install, run, and update apps in the private storage of a Qube Building instrutions

Micah Lee 26 Dec 27, 2022
Similar looking domain detection using python fuzzywuzzy

Major cause of phishing and BEC incident is similar looking domain, if you detect it early, you can prevent incidents early, python fuzzywuzzy module let you do that

2 Nov 07, 2021
password generator

Password generator technologies used What is? It is Password generator How to Download? Download on releases Clone repo git clone https://github.com/m

1 Dec 16, 2021
Hot reloading for Python

Hot reloading for Python

Olivier Breuleux 769 Jan 03, 2023
Find dependent python scripts of a python script in a project directory.

Find dependent python scripts of a python script in a project directory.

2 Dec 05, 2021
More routines for operating on iterables, beyond itertools

More Itertools Python's itertools library is a gem - you can compose elegant solutions for a variety of problems with the functions it provides. In mo

2.9k Jan 06, 2023
✨ Un pierre feuille ciseaux totalement fait en Python par moi, et en français.

Pierre Feuille Ciseaux ❗ Un pierre feuille ciseaux totalement fait en Python par moi. 🔮 Avec l'utilisation du module "random", j'ai pu faire un choix

MrGabin 3 Jun 06, 2021
A small python tool to get relevant values from SRI invoices

SriInvoiceProcessing A small python tool to get relevant values from SRI invoices Some useful info to run the tool Login into your SRI account and ret

Wladymir Brborich 2 Jan 07, 2022
Teleport Ur Logs with Love

Whatever you pipe into tull, will get a unique UUID and the data gets stored locally - accessible via a flask server with simple endpoints. You can use ngrok or localtunnel then to share it outside L

Lokendra Sharma 11 Jul 30, 2021