AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]] 

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 ">
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 ">
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)
  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
PyChemia, Python Framework for Materials Discovery and Design

PyChemia, Python Framework for Materials Discovery and Design PyChemia is an open-source Python Library for materials structural search. The purpose o

Materials Discovery Group 61 Oct 02, 2022
💬 Python scripts to parse Messenger, Hangouts, WhatsApp and Telegram chat logs into DataFrames.

Chatistics Python 3 scripts to convert chat logs from various messaging platforms into Pandas DataFrames. Can also generate histograms and word clouds

Florian 893 Jan 02, 2023
PyTorch implementation for NCL (Neighborhood-enrighed Contrastive Learning)

NCL (Neighborhood-enrighed Contrastive Learning) This is the official PyTorch implementation for the paper: Zihan Lin*, Changxin Tian*, Yupeng Hou* Wa

RUCAIBox 73 Jan 03, 2023
INF42 - Topological Data Analysis

TDA INF421(Conception et analyse d'algorithmes) Projet : Topological Data Analysis SphereMin Etant donné un nuage des points, ce programme contient de

2 Jan 07, 2022
Statistical Analysis 📈 focused on statistical analysis and exploration used on various data sets for personal and professional projects.

Statistical Analysis 📈 This repository focuses on statistical analysis and the exploration used on various data sets for personal and professional pr

Andy Pham 1 Sep 03, 2022
Techdegree Data Analysis Project 2

Basketball Team Stats Tool In this project you will be writing a program that reads from the "constants" data (PLAYERS and TEAMS) in constants.py. Thi

2 Oct 23, 2021
Tools for working with MARC data in Catalogue Bridge.

catbridge_tools Tools for working with MARC data in Catalogue Bridge. Borrows heavily from PyMarc

1 Nov 11, 2021
Program that predicts the NBA mvp based on data from previous years.

NBA MVP Predictor A machine learning model using RandomForest Regression that predicts NBA MVP's using player data. Explore the docs » View Demo · Rep

Muhammad Rabee 1 Jan 21, 2022
A tool to compare differences between dataframes and create a differences report in Excel

similarpanda A module to check for differences between pandas Dataframes, and generate a report in Excel format. This is helpful in a workplace settin

Andre Pretorius 9 Sep 15, 2022
An Indexer that works out-of-the-box when you have less than 100K stored Documents

U100KIndexer An Indexer that works out-of-the-box when you have less than 100K stored Documents. U100K means under 100K. At 100K stored Documents with

Jina AI 7 Mar 15, 2022
X-news - Pipeline data use scrapy, kafka, spark streaming, spark ML and elasticsearch, Kibana

X-news - Pipeline data use scrapy, kafka, spark streaming, spark ML and elasticsearch, Kibana

Nguyễn Quang Huy 5 Sep 28, 2022
Elementary is an open-source data reliability framework for modern data teams. The first module of the framework is data lineage.

Data lineage made simple, reliable, and automated. Effortlessly track the flow of data, understand dependencies and analyze impact. Features Visualiza

898 Jan 09, 2023
A Pythonic introduction to methods for scaling your data science and machine learning work to larger datasets and larger models, using the tools and APIs you know and love from the PyData stack (such as numpy, pandas, and scikit-learn).

This tutorial's purpose is to introduce Pythonistas to methods for scaling their data science and machine learning work to larger datasets and larger models, using the tools and APIs they know and lo

Coiled 102 Nov 10, 2022
MIR Cheatsheet - Survival Guidebook for MIR Researchers in the Lab

MIR Cheatsheet - Survival Guidebook for MIR Researchers in the Lab

SeungHeonDoh 3 Jul 02, 2022
A fast, flexible, and performant feature selection package for python.

linselect A fast, flexible, and performant feature selection package for python. Package in a nutshell It's built on stepwise linear regression When p

88 Dec 06, 2022
PyPDC is a Python package for calculating asymptotic Partial Directed Coherence estimations for brain connectivity analysis.

Python asymptotic Partial Directed Coherence and Directed Coherence estimation package for brain connectivity analysis. Free software: MIT license Doc

Heitor Baldo 3 Nov 26, 2022
Python tools for querying and manipulating BIDS datasets.

PyBIDS is a Python library to centralize interactions with datasets conforming BIDS (Brain Imaging Data Structure) format.

Brain Imaging Data Structure 180 Dec 18, 2022
Developed for analyzing the covariance for OrcVIO

about This repo is developed for analyzing the covariance for OrcVIO environment setup platform ubuntu 18.04 using conda conda env create --file envir

Sean 1 Dec 08, 2021
This cosmetics generator allows you to generate the new Fortnite cosmetics, Search pak and search cosmetics!

COSMETICS GENERATOR This cosmetics generator allows you to generate the new Fortnite cosmetics, Search pak and search cosmetics! Remember to put the l

ᴅᴊʟᴏʀ3xᴢᴏ 11 Dec 13, 2022
Top 50 best selling books on amazon

It's a dashboard that shows the detailed information about each book in the top 50 best selling books on amazon over the last ten years

Nahla Tarek 1 Nov 18, 2021